Cellule e molecole

I geni sono dei progetti per la costruzione delle proteine

Nei geni ci sono le istruzioni per la costruzione delle proteine. Immagine: CanStockPhoto

Nel capitolo precedente abbiamo imparato che il DNA è composto da quttro elementi che sono designati dalle lettere A, T, G e C.

Si può quindi dire che il nucleo di ogni cellula del tuo corpo contiene un libro, scritto con le lettere A, T, G e C. Un gene corrisponde a una frase di questo libro. Il numero esatto di geni che un essere umano possiede non è ancora stato determinato in maniera precisa, ma gli esperti stimano un numero compreso tra 20000 e 25000. Essi rappresentano collettivamente solo il due per cento del nostro patrimonio genetico. I geni non sono composti dallo stesso numero di lettere, poiché un gene corto conta circa 500 lettere, mentre un gene lungo ne ha diverse migliaia.

In tutte le cellule si trova lo stesso libro, con la medesima successione di lettere. Una particolare cellula legge solo le frasi (geni) contenenti le informazioni che le sono necessarie in un determinato momento per poter compiere la funzione che ha nel corpo. Una cellula sanguigna, infatti, non legge esattamente le stesse frasi (geni) di una cellula muscolare.

Nel nucleo vengono fatte copie dei geni

Prima che una cellula possa leggere un gene, viene fatta una copia nel nucleo cellulare. A questo proposito, i due filamenti di DNA si separano nel punto in cui si trova il gene in questione, così che le coppie A-T e G-C risultino disaccoppiate. In seguito, un duplicatore (chiamato RNA polimerasi) situato a sua volta nel nucleo utilizza uno dei due filamenti come stampo per copiare la sequenza di lettere. Questo processo genera una copia del gene. Riprendendo l'esempio del libro, si può dire che la cellula ha fatto una copia di una frase del libro del nucleo che le interessa in modo particolare.

Una differenza nella sequenza di lettere tra l'originale del gene e la sua copia è che le Timine (T) sono rimpiazzate dall'Uracile (U). La sequenza originale si compone quindi di A, T, G e C, mentre la copia di A, U, G e C. Inoltre, l'originale è composta di Acido DesossiriboNucleico, o DNA, mentre la copia è costituita di Acido RiboNucleico, o RNA.

Dalla copia del gene viene prodotta una catena di amminoacidi

La copia del gene viene trasportata fuori dal nucleo cellulare. Essa viene poi letta dalle fabbriche di proteine della cellula: i ribosomi. I ribosomi leggono la frase (copia del gene) dall'inizio alla fine, tre lettere per volta. Se una frase è composta, per esempio, da AUGGUGCACCUGACUCCUGAGGAGAAG, i ribosomi leggeranno AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.

Nella copia del gene sono scritte le istruzioni per la fabbricazione di una data proteina. Questo è possibile perché tutte le proteine, indipendentemente dalla loro complessità, sono formate da elementi base chiamati amminoacidi posti in una sequenza ben precisa. Esistono 20 amminoacidi diversi; ciascuna tripletta di lettere rappresenta un determinato amminoacido. GUC, per esempio, corrisponde all'amminoacido chiamato "valina", mentre CAC è codifica l'amminoacido "istidina". Questo codice permette quindi alla cellula di tradurre le parole di tre lettere in amminoacidi e viene detto codice genetico. Quando i ribosomi leggono una frase (copia del gene) suddividendola in gruppi di tre lettere sanno esattamente quale dei venti amminoacidi è associato ad ogni parola di tre lettere e qual è la loro sequenza; assemblano così gli amminoacidi uno dopo l'altro secondo la data sequenza fino ad ottenere la proteina completa.

Anche un solo errore di scrittura presente nella copia del gene può generare una proteina difettosa. Nel punto in cui si trova l'errore di ortografia, infatti, i ribosomi inseriranno un amminoacido sbagliato. Una simile svista può avere gravi conseguenze. Per esempio, in una malattia chiamata anemia falciforme le cellule sanguigne hanno una forma diversa da quella normale per colpa di una proteina difettosa e funzionano peggio di quelle delle persone sane.

Video sul tema

Creato: 23.05.2017

Questo articolo è stato importato automaticamente dal nostro vecchio sito. Si prega di segnalare eventuali errori di visualizzazione a redazione(at)simplyscience.ch. Grazie per la collaborazione!

Il contenuto proviene dall’ex sito internet gene-abc.ch, che è stato integrato nel sito internet di SimplyScience.ch nel gennaio 2016. Geni ABC era un’iniziativa del Fondo Nazionale Svizzero per la ricerca scientifica e viene mandato avanti dalla fondazione SimplyScience.

Di più