Gene sind Protein-Baupläne

Gene beschreiben, wie die Zelle ein bestimmtes Protein herstellen soll.

Wie ein Protein aufgebaut ist, steht bereits in den Genen. Bild: CanStockPhoto

Wie im Artikel Chromosomen sind aufgewickelte Gen-Fäden beschrieben, werden die Bausteine der DNA mit den Buchstaben A, C, G und T abgekürzt. Im Kern jeder Körperzelle steckt sozusagen ein Buch, das mit den Buchstaben A, C, G und T geschrieben ist. Ein Gen entspricht dabei einem bestimmten Satz in diesem Buch. Heute wissen wir, dass Menschen zwischen 20'000 und 25'000 Gene besitzen. Zusammen entsprechen sie allerdings nur zwei Prozent des menschlichen Erbguts (der Rest hat andere Funktionen, die noch nicht alle geklärt sind). Nicht jedes Gen hat die gleiche Anzahl Buchstaben. Ein kleines Gen ist etwa 500 Buchstaben lang, ein grosses kann mehrere Hunderttausend Buchstaben umfassen


In allen Körperzellen steckt das gleiche Buch mit der gleichen Buchstaben-Abfolge. Jede Zelle liest nur diejenigen Sätze (Gene) ab, welche die Informationen enthalten, die sie gerade braucht, um ihre Aufgabe im Körper zu erfüllen. Eine Blutzelle liest also nicht genau dieselben Sätze (Gene) ab wie eine Muskelzelle.

Im Zellkern wird eine Gen-Kopie hergestellt

Bevor eine Zelle ein Gen überhaupt lesen kann, muss im Zellkern zuerst eine Kopie davon hergestellt werden. Dabei trennen sich die beiden Stränge der DNA an der Stelle, wo sich das Gen befindet, so dass die Buchstaben A, C, G und T freiliegen. Der Kopierapparat (die sogenannte RNA-Polymerase) im Zellkern benutzt dann einen dieser beiden Stränge als Vorlage, um Buchstabe für Buchstabe abzuschreiben. So entsteht eine Kopie des Gens. In unserem Vergleich mit dem Buch würde dies heissen, dass vom Buch im Zellkern ein Satz abgeschrieben wird.

Zwischen dem Gen-Original und der Gen-Kopie gibt es einen Unterschied: Anstelle des Bausteins Thymin (T) wird der Baustein Uracil (U) eingebaut. Das Gen-Original besteht also aus den Bausteinen A, C, G und T, während die Gen-Kopie aus den Bausteinen A, C, G und U zusammengesetzt ist. Die Gen-Kopie ist deshalb kein DNA-Molekül, sondern ein RNA-Molekül. RNA steht für Ribonukleinsäure (bzw. „ribonucleic acid“ im Englischen).

Aus der Gen-Kopie entsteht eine Aminosäuren-Kette

Die Gen-Kopie wandert aus dem Zellkern und wird von den Ribosomen (den „Fabriken“) der Zelle gelesen. Das Ribosom liest die Gen-Kopie (den Satz) vom Anfang bis zum Ende durch. Dabei liest sie immer genau drei Buchstaben am Stück. Steht in einer Kopie z. B. AUGGUGCACCUGACUCCUGAGGAGAAG geschrieben, so liest die Fabrik AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.

In einem Gen steht geschrieben, wie das Ribosom ein bestimmtes Protein herstellen soll. Proteine werden aus Bausteinen hergestellt, die man Aminosäuren nennt. Es gibt zwanzig verschiedene Aminosäuren. Jeweils drei bestimmte Buchstaben stehen für eine bestimmte Aminosäure. GUG beispielsweise bedeutet „Aminosäure Valin“, und CAC heisst „Aminosäure Histidin“. Den Übersetzungsschlüssel nennt man den genetischen Code. Liest das Ribosom also ein Gen im 3-Buchstaben-Rhythmus durch, so weiss es ganz genau, welche der zwanzig Aminosäuren es in welcher Reihenfolge aneinanderreihen muss. Das Ribosom fügt dann eine Aminosäure nach der anderen zusammen, bis schliesslich das komplette Protein vorliegt.

Ein einziger Schreibfehler in einer Gen-Kopie kann dazu führen, dass das Ribosom ein defektes anstelle eine gesunden Proteins produziert. Dort, wo der Schreibfehler ist, baut das Ribosom eine falsche Aminosäure ein. Dieser Fehler kann unterschiedliche, teils schwere, Folgen haben. Das Beispiel der Krankheit Sichelzellanämie zeigt, was ein defektes Protein bewirken kann: Blutzellen von Menschen mit Sichelzellanämie sehen ganz anders aus als diejenigen von gesunden Menschen und führen zu diversen gefährlichen Symptomen.

Dieser Beitrag integriert Inhalte von der ehemaligen Website gene-abc.ch, die im Jahr 2016 von SimplyScience übernommen wurde. Das Gene ABC war eine Initiative des Schweizerischen Nationalfonds zur Förderung der wissenschaftlichen Forschung (SNF) und umfasste auch eine Reihe von YouTube-Videos.