Gene sind Eiweiss-Baupläne

Wie ein Protein aufgebaut ist, steht bereits in den Genen. Bild: CanStockPhoto

Im letzten Kapitel haben wir gesehen: Die Bausteine der DNS werden mit den Buchstaben A, C, G und T abgekürzt.

Man kann sagen: Im Kern jeder deiner Körperzellen steckt ein Buch, das mit den Buchstaben A, C, G und T geschrieben ist. Ein Gen entspricht dabei einem bestimmten Satz in diesem Buch. Heute wissen wir, dass Menschen zwischen 20'000 und 25'000 Gene haben. Zusammen entsprechen sie nur zwei Prozent unseres Erbguts. Nicht jedes Gen hat die gleiche Anzahl Buchstaben. Ein kleines ist etwa 500 Buchstaben lang und ein grosses mehrere hunderttausend.

In allen deinen Körperzellen steckt das gleiche Buch mit der gleichen Buchstaben-Abfolge. Eine bestimmte Zelle liest nur diejenigen Sätze (Gene) durch, die die Informationen enthalten, die sie gerade braucht, um ihre Aufgabe im Körper erfüllen zu können. Eine Blutzelle liest also nicht genau die gleichen Sätze (Gene) durch wie eine Muskelzelle.

Im Zellkern wird eine Gen-Kopie hergestellt

Bevor eine Zelle ein Gen überhaupt lesen kann, muss im Zellkern zuerst eine Kopie davon hergestellt werden. Dabei trennen sich die beiden Stränge der DNS an der Stelle, wo sich das Gen befindet, so dass die Buchstaben A, C, G und T freiliegen. Der Kopierapparat (RNS-Polymerase) im Zellkern benutzt dann einen dieser beiden Stränge als Vorlage, um Buchstabe für Buchstabe abzuschreiben. So entsteht eine Kopie des Gens. Wenn wir den Vergleich mit dem Buch machen, so kann man sagen: Vom Buch im Zellkern wird ein Satz abgeschrieben.

Zwischen dem Gen-Original und der Gen-Kopie gibt es einen Unterschied: Anstelle des Bausteins Thymin (T) tritt der Baustein Uracil (U). Das Gen-Original besteht also aus den Bausteinen A, C, G und T, während die Gen-Kopie aus den Bausteinen A, C, G und U zusammengesetzt ist. Die Gen-Kopie ist also kein DNS-Molekül, sondern man nennt diese Substanz RNS oder RNA (für Ribonukleinsäure bzw. – englisch – ribonucleic acid).

Aus der Gen-Kopie entsteht eine Aminosäuren-Kette

Die Gen-Kopie wandert aus dem Zellkern und wird von den Fabriken (Ribosomen) der Zelle gelesen. Die Fabrik liest den Satz (Gen-Kopie) vom Anfang bis zum Ende durch. Dabei liest sie immer genau drei Buchstaben am Stück. Steht in einem Satz z.B. AUGGUGCACCUGACUCCUGAGGAGAAG geschrieben, so liest die Fabrik AUG, GUG, CAC, CUG, ACU, CCU, GAG, GAG, AAG.
In einem Gen steht geschrieben, wie die Fabrik ein bestimmtes Eiweiss herstellen muss. Eiweisse werden aus Bausteinen hergestellt, die man Aminosäuren nennt. Es gibt zwanzig verschiedene Aminosäuren. Jeweils drei bestimmte Buchstaben stehen für eine bestimmte Aminosäure. GUG z.B. heisst "Aminosäure Valin", oder CAC heisst "Aminosäure Histidin". Den Übersetzungsschlüssel nennt man den genetischen Code. Liest die Fabrik also ein Gen im 3-Buchstaben-Rhythmus durch, so weiss sie ganz genau, welche der zwanzig Aminosäuren sie in welcher Reihenfolge aneinander reihen muss. Die Fabrik fügt dann eine Aminosäure nach der anderen zusammen, bis schlussendlich das komplette Eiweiss vorliegt.

Ein einziger Schreibfehler in einem Satz (Gen-Kopie) kann dazu führen, dass die Fabrik ein defektes anstatt ein gesundes Eiweiss produziert. Dort, wo der Schreibfehler ist, baut die Fabrik eine falsche Aminosäure ein. Dieser Fehler hat schwere Folgen wie das Beispiel der Krankheit Sichelzellanämie zeigt. Ein defektes Eiweiss bewirkt, dass Blutzellen von diesen Patienten ganz anders aussehen als bei gesunden Menschen.

Video zum Text

Für weitere Informationen lies auch die Artikel "Von der DNA zum Protein" und "Der genetische Code".

Dieser Beitrag integriert Inhalte von der ehemaligen Website, die im Jahr 2016 von SimplyScience übernommen wurde. Das Gene ABC war eine Initiative des Schweizerischen Nationalfonds zur Förderung der wissenschaftlichen Forschung (SNF) und umfasste auch eine Reihe von YouTube-Videos.